gltP [2019-04-22 18:53:46]

similar to H⁺/glutamate symporter, minor glyphosate transporter

Locus: BSU02340

Isoelectric point: 8.65

Molecular weight: 44.45 kDa

Protein length: 414 aa

Gene length: 1245 bp

Function: unknown

Product: similar to H⁺/glutamate symporter

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Dicarboxylate/amino acid:cation symporter
• Groups of genes → Membrane proteins

Gene

Coordinates: 253,518 254,762

The protein

Catalyzed reaction/ biological activity

• uptake of glyphosate PubMed

Protein family

• dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family (according to UniProt)

Paralogous protein(s)

• DctP, GltT

Structure

• 4KY0 the glutamate transporter of Thermococcus kodakarensis, 33% identity, 68% similarity) PubMed

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: gltP
  Description: PubMed

Biological materials

Mutant

• ADB1 (gltP::neo trpC2 pheA1 available in Erhard Bremer's and Jörg Stülke's labs PubMed
• BP234 (gltP::cat), available in Fabian Commichau's lab
• BP235 (gltT::spc gltP::cat), available in Fabian Commichau's lab
• BKE02340 (gltP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA, downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
• BKK02340 (gltP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA, downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
• MDB52 (gltP::cat trpC2 pheA1 available in Erhard Bremer's and Jörg Stülke's labs PubMed
• GP2799 (ΔgltP::kan), available in Jörg Stülke's lab
• GP2824 (ΔgltP::cat), available in Jörg Stülke's lab

References

Loading